Open Access

Pigsties near dwellings as a potential risk factor for the prevalence of Japanese encephalitis virus in adult in Shanxi, China

  • Xiaojie Ren1,
  • Shihong Fu2, 3,
  • Peifang Dai4,
  • Huanyu Wang2, 3,
  • Yuanyuan Li1,
  • Xiaolong Li2, 3,
  • Wenwen Lei2, 3,
  • Xiaoyan Gao2, 3,
  • Ying He2, 3,
  • Zhi Lv2, 3,
  • Jingxia Cheng4,
  • Guiqin Wang1Email author and
  • Guodong Liang2, 3Email author
Contributed equally
Infectious Diseases of Poverty20176:100

DOI: 10.1186/s40249-017-0312-4

Received: 4 November 2016

Accepted: 28 April 2017

Published: 8 June 2017

Abstract

Background

The increasing trend of adult cases of Japanese encephalitis (JE) in China, particularly in northern China, has become an important public health issue. We conducted an epidemiological investigation in the south of Shanxi Province to examine the relationships between mosquitoes, Japanese encephalitis virus (JEV), and adult JE cases.

Methods

Mosquito specimens were collected from the courtyards of farmers’ households and pig farms in Shanxi Province. Mosquitoes were pooled, homogenized, and centrifuged. Reverse transcription-polymerase chain reaction (RT-PCR) was used to detect mosquito-borne arbovirus genes in homogenates. Specimens positive for these genes were inoculated into the baby hamster kidney cell line (BHK-21) to isolate virus. Minimum infection rate was calculated and phylogenetic analyses were performed.

Results

A total of 7 943 mosquitoes belonging to six species in four genera were collected; Culex tritaeniorhynchus accounted for 73.08% (5 805/7 943), C. pipiens pallens for 24.75% (1 966/7 943), and the remaining 3% (104/ 7943) consisted of Anopheles sinensis, Aedes vexans, Ae. dorsalis, and Armigeres subalbatus. Sixteen pools were positive for JEV based on RT-PCR using JEV pre-membrane gene nested primers. Phylogenetic analyses showed that all JEVs belonged to genotype I; two pools were positive using Getah Virus (GETV) gene primers. In addition, one JEV strain (SXYC1523) was isolated from C. pipiens pallens specimens. These results indicate that the minimum infection rate of JEV in mosquito specimens collected from the courtyards of farmers’ households with pigsties was 7.39/1 000; the rate for pig farms was 2.68/1 000; and the rate for farmers’ courtyards without pigsties was zero.

Conclusions

The high-prevalence regions of adult JE investigated in this study are still the natural epidemic focus of JEV. Having pigsties near dwellings is a potential risk factor contributing to the prevalence of adult JE. To prevent the occurrence of local adult JE cases, a recommendation was raised that, besides continuing to implement the Expanded Program on Immunization for children, the government should urge local farmers to cease raising pigs in their own courtyards to reduce the probability of infection with JEV.

Keywords

Adult Japanese encephalitis Epidemic disease Mosquito-borne arbovirus Japanese encephalitis virus

Multilingual abstracts

Please see Additional file 1 for translations of the abstract into the six official working languages of the United Nations.

Background

Japanese encephalitis (JE) is a central nervous system disease caused by Japanese encephalitis virus (JEV), which has severe symptoms and a fatality rate of 30%. About 35% of survivors have permanent neurological or psychiatric sequelae [1, 2]. JEV is transmitted by mosquitoes, among which Culex tritaeniorhynchus is the most important vector. Pigs and migratory birds are primary amplification hosts [13]. JE is mainly epidemic in developing countries in Asia such as China, India, Thailand, Vietnam, Myanmar, Laos, and Indonesia. It is also the most important form of viral encephalitis in these regions [3, 4]. JE mainly occurs in children up to 14 years old [14], but adult cases have been reported in recent years. In 2006, 66 cases of JE were reported with 22 deaths in Shanxi Province, China, among which only 1 patient was 4 years old and more than 86% were over 30 years old [5]. In recent years, the number of adult cases has exceeded pediatric cases in some endemic areas in India [6]. In addition, 129 cases were reported in South Korea during 2010–2015, among which patients older than 40 years accounted for 61.2% [7]. Therefore, the epidemic of adult JE in local regions has become a new public health issue.

China has the highest prevalence rates of JE, accounting for nearly 50% of the total number of cases reported around the world annually [4]. In 2008, China has included JE vaccination in the Expanded Program on Immunization (EPI), and children ≤15 years old in JE-endemic areas can be inoculated with JE vaccine at no cost; this has greatly reduced the incidence of JE in children [810]. However, the incidence of adult cases in some provinces of China is higher than the national average, and the increased proportion of cases in adults is much higher than that in children [10]. The increase in adult JE cases, particularly in patients over 40 years old, has gradually become the driving factor for the high national incidence of JE from 2004 to 2014 in China. Previous studies have shown that the number of JE cases in the ≤15 years old group decreased by 17% in 2013, while that in people >40 years old increased by 394.16% compared to 2012 [10]. There are six high-prevalence provinces for adult JE (Shanxi, Shandong, Henan, Hebei, Shaanxi, and Gansu), all of them located in north of the Yangtze River (30°N–35°N and 110°E–130°E). Spatial cluster analyses have suggested that the distribution of adult cases in the south of Shanxi Province have demonstrated spatial clusters in years with high JE prevalence rates. Thus, the high incidence of adult JE in the southern region of Shanxi Province has become a heavy burden on local public health [10].

A total of 253 JE cases were reported in Shanxi province from 2009 to 2014, among which adult JE cases (over 40 years old) accounted for 83% (210/253). The adult cases were mainly distributed in Linyi, Yongji, and Wanrong counties, accounting for 35.7% (75/210) of the total (Fig. 1). Therefore, we conducted an investigation in these three counties to understand the relationships between local mosquito vectors, JEV, and local adult JE cases.
Fig. 1

Geographical distribution of adult JE cases in Shanxi Province from 2009 to 2014, and the collection sites of mosquito specimens in this study. The triangles represent Wanrong, Linyi, and Yongji from top to bottom in the figure, respectively

Methods

Cells

The baby hamster kidney cell line (BHK-21) was used for virus isolation. Cells were cultured with Dulbecco’s Modified Eagle’s Medium (DMEM) (Gibco, Grand Island, NY), 6% fetal bovine serum (FBS) (Gibco), 1% 100 U/ml penicillin and streptomycin (prepared by the Institute of Virology), and maintained at 37 °C under an atmosphere of 5% CO2 [11, 12].

Mosquito collection

Previous papers showed that the mosquito density peaked from June to August and August has the highest mosquito density in the study area. The study area is on the east coast of the Yellow River. In summer, it is hot and rainy suitable for mosquito breeding, which is in June to August. Farmers grow wheat, corn, rice, cotton, potato, sorghum, millet, soybean, apple and so on. Vegetation is dominated by deciduous broad-leaf forest. JE cases peaked in June and August in Shanxi Province. So we collected mosquitoes from August 17 to 23, 2015 [5, 9]. The three counties are located between 34.8°N and 35.4°N, 110.3°E and 110.83°E (Fig. 1) in the Yellow River basin, which includes a large part of the Yellow River alluvial plain. Therefore, there are abundant rivers and lakes. Mosquito specimens were collected throughout this region, in villages with populations of about 800–1 000 people (200–300 households) per village. The distance between each village was more than 5 km. The investigation sites were divided into three categories, as follows.
  1. 1)

    Courtyards of farmers’ households with pigsties: there were not only houses for human habitation, but also pigsties for 5–10 pigs in the courtyard. The pigs were all raised in the courtyards, and there were no large-scale pig farms in these villages.

     
  2. 2)

    Courtyards of farmers’ households without pigsties: all pigs were intensively bred in pig farms 2 km from the village. Therefore, there were no pigs raised in the farmers’ courtyards in these villages.

     
  3. 3)

    Pig farms: the pig farms with intensive breeding of about 1 000 pigs were located 2 km from the villages. Residents in the village rented them according to the number of pigs they owned. Full-time personnel were responsible for the daily breeding and management of pigs on the farms.

     

Mosquitoes were collected with Ultraviolet light traps (Wuhan Lucky Star Environmental Protection Technology Co. Ltd., Hubei, China) and MT-1 CO2 mosquito traps (Beijing Detailong Science and Technology Development Co. Ltd., Beijing, China). The traps were set before sunset at 5:00 PM and mosquitoes were collected from them the following morning at 7:00 AM. The trapped mosquitoes were killed by freezing at –20 °C for 30 min. The specimens were placed on ice, and identified under a microscope for morphological classification. Male mosquitoes were excluded. Female mosquitoes were combined into different pools ≤120 specimens according to species, collection site, and collection time. The information was marked and registered. The specimens were stored in liquid nitrogen until they were examined in the laboratory [11, 12].

Virus isolation

Pools of mosquito specimens were homogenized using a Mixer Mill Tissuelyser II (Qiagen, Hilden, Germany) at 25 times per second for 3 min with stainless steel beads (r = 3 mm) in 2 ml sterile plastic tubes containing 1.5 ml Eagle’s medium supplemented with 5% 100 U/ml penicillin and streptomycin, 1% 30 g/L glutamine, and 1% 75 g/L NaHCO3. Then the samples were centrifuged at 13 000 rpm, 4 °C, for 30 min.

Aliquots of 100 μl clarified homogenates were inoculated into 5.5 cm2 Nunc tubes (Nunc, Roskilde, Denmark) covered with a BHK cell monolayer containing 100 μl Eagle’s medium for 1 h at 37 °C under an atmosphere of 5% CO2. Then the medium was replaced with 2 ml fresh medium and the tubes were maintained at 37 °C under an atmosphere of 5% CO2. The cytopathic effect (CPE) was examined every 8 h for 5 days. Control BHK-21 cells were also examined at each stage. At 70% CPE, the samples were stored at –80 °C until identification. Those without a CPE were blindly passaged for three successive generations in the same way [11, 12].

RT-PCR and molecular identification

RNA was extracted from 140 μl aliquots of clarified homogenates or virus culture stocks with a Viral RNA Mini Kit (QIAamp; Qiagen, Valencia, CA) in accordance with the manufacturer’s protocol. Then the viral RNA was used as the template to prepare cDNA with random primers (6-mer) (Takara, Otsu, Japan) using Ready-To-Go™ You-Prime FirstStrand Beads (GE Healthcare, Little Chalfont, Buckinghamshire, UK). The primers used for mosquito-borne virus gene detection are shown in Table 1 [1215]. In this study, we detected not only JEV genes but also common arboviruses that had been discovered in local mosquito specimens. PCR was performed with GoTaq® Green Master Mix, 2× (Promega, Madison, WI) using a Mastercycler (Eppendorf, Hamburg, Germany) as follows: initial denaturation at 95 °C for 4 min followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 1 min, with a final extension at 72 °C for 10 min. Amplified products were detected by 1% agarose gel electrophoresis and sequenced. BLAST searches of the nucleotide sequences obtained were conducted against GenBank to identify the types of virus genes in the specimens [11, 12].
Table 1

Primers used for identification in this studya

Primers

Sequence of primers (5′–3′)

Amplify region

Length of product (reference)

Flavivius

 FU1

TACCACATGATGGGAAAGAGAGAGAA

NS5

310 [11]

 CFD2

GTGTCCCAGCCGGCGGTGTCATCAGC

Alphavirus

 M2W

YAGAGCDTTTTCGCAYSTRGCHW

NS1

434/310 [11]

 cM3W

ACATRAANKGNGTNGTRTCRAANCCDAYCC

 M2W2

TGYCCNVTGMDNWSYVCNGARGAYCC

Bunyaviruses

 BUP

ATGACTGAGTTGGAGTTTGATGTCGC

S

251 [13]

 BDW

TGTTCCTGTTGCCAGGAAAAT

BAV S12 gene primers

 BAV-12-854-S

AAATTGATAGYGYTTGCGTAAGAC

S12

850 [11]

 BAV-12-B2-R

GTTCTAAATTGGATACGGCGTGC

LNV S12 gene primers

 LNV12s1

CACTGGCTCCGGCTGTAGTAACAG

S12

435 [14]

 LNV12r1

CTGTTCGGATCATCTGGAATTTGA

GETV 5′UTR and NS1 gene primers

 F1

ATGGCGGACGTGTGACATCAC

5′UTR,NS1

930 [15]

 R1

GTAACCTTCGCATGACACCACC

JEV C/PrM gene primers

 JE-251 F

CGTTCTTCAAGTTTACAGCATTAGC

C/PrM

674/492 [5]

 JE-925R

CCYRTGTTYCTGCCAAGCATCCAMCC

 JE-743R

CGYTTGGAATGYCTRGTCCG

F, Forward primer; R, Reverse primer; M, C/A; W, A/T; Y, C/T; K, G/T; R, G/A; V, G/A/C; D, T/A/G; BAV, Bannan virus; LNV, Liaoning virus; GETV, Getach virus; JEV, Japanese encephalitis virus

a The primers used to amplify the complete open reading frame (ORF) nucleotide sequence and envelope gene of the viral genomic RNA were all from a previous study [23]

Minimum infection rate

Minimum infection rate (MIR) was calculated as the (number of pools positive for JEV/total number of specimens tested) × 1 000, assuming that every positive pool contained only one infected mosquito. This was calculated for each mosquito species and each mosquito collection site during the study [16].

Phylogenetic analysis

Seqman software (DNAStar, Madison, WI) was used for sequence splicing and quality analysis of the original nucleotide sequence. Additional JEV sequences were downloaded from GenBank. The JEV strains used in this study with source and region of isolation are listed in Table 2. BioEdit software (version 7.0.5.3; Thomas) was used for multiple alignment by ClustalW.MegAlin software (DNAStar) was used to convert nucleotide sequences into amino acid sequences and to separately compare nucleotide and amino acid sequence identities.
Table 2

Strains of Japanese encephalitis virus used in this study

Strain

Genotype

Year

Country and region

Source

GenBank accession No.

E gene

Complete gene

SXYC1523*

I

2015

Shanxi,China

Culex pipiens

KY078829

KY078829

SXYC1546*

I

2015

Shanxi,China

C. tritaeniorhynchus

KY078827

 

SXYC1548*

I

2015

Shanxi,China

C. tritaeniorhynchus

KY078828

 

Ishikawa

I

1994

Ishikawa, Japan

Swine mononuclear cells

AB051292

AB051292

JEV/sw/Mie/40/2004

I

2004

Japan

Pig serum

AB241118

AB241118

12-YJ033

I

2012

Shanxi,China

C. tritaeniorhynchus

KP216590

 

SX09S-01

I

2008

Shanxi,China

Pig brain

HQ893545

HQ893545

12-LY039

I

2012

Shanxi,China

C. pipiens

KP216598

 

12-YJ022

I

2012

Shanxi,China

C. tritaeniorhynchus

KP216587

 

XJ69

I

2007

China

C. pipiens pallens

EU880214

EU880214

SH03-130

I

2003

Shanghai, China

C. tritaeniorhynchus

DQ404104

 

KV1899

I

1999

Korea

Pig serum

AY316157

AY316357

YN79-Bao83

I

1979

Yunan, China

C. tritaeniorhynchus

DQ404128

 

YN-Xiang JE

I

IU

Yunan, China

Human blood

DQ404135

 

LN02-102

I

2002

Liaoning, China

C. modestus

DQ404085

 

SH03-105

I

2003

Shanghai, China

C. tritaeniorhynchus

DQ404097

 

HN06-21

I

2006

Henan, China

Culex

JN381830

 

HN06-26

I

2006

Henan, China

Culex

JN381837

 

SC04-12

I

2004

Sichuan, China

Culex

DQ404090

 

GZ56

I

2008

Guizhou, China

Cerebrospinal fluid

HM366552

HM366552

JEV/sw/Mie/41/2002

I

2002

Mie, Japan

Swine serum

AB241119

AB241119

K94P05

I

1994

South Korea

C. tritaeniorhynchus

AF045551

AF045551

XJP613

I

2007

China

C. tritaeniorhynchus

EU693899

EU693899

FU

II

1995

Australia

Human sreum

AF217620

AF217620

SA14

III

1954

China

Mosquito

U14163

U14163

SA14-14-2

III

IU

China

Vaccine

AF315119

AF315119

P3

III

1949

Beijing, China

Human brain

U47032

U47032

Nakayama-RFVL

III

1935

Nakayama, Japan

Human brain

S75726

 

GZ04-36

III

2004

Guizhou, China

Culex

DQ404112

 

HLJ02-134

III

2002

Heilongjiang, China

Culicoides

DQ404081

 

FJ03-31

III

2003

Fujian, China

Human blood

DQ404117

 

SH0601

III

2006

Shanghai, China

Pig

EF543861

EF543861

K87P39

III

1987

Korea

Mosquito

AY585242

AY585242

JaGAr01

III

1959

Japan,Gunma

C. tritaeniorhynchus

AF039076

AF039076

RP-9

III

1985

Taiwan,China

Mosquito

AF14161

AF14161

T1P1

III

1997

Taiwan,China

Armigeres subalbatus

AF254453

AF254453

Beijing-1

III

1949

Beijing, China

Human brain

L48961

L48961

Ling

III

1965

Taiwan,China

Mosquito

L78128

L78128

P20778

III

1958

India

Human brain

AF080251

AF08251

JKT6468

IV

1981

Indonesia,Flores

C. tritaeniorhynchus

AY184212

AY184212

Muar

V

1952

Malaysia

Human brain

HM596272

HM596272

XZ0934

V

2009

China

Mosquito

JF915894

JF915894

MVE

 

1951

Australia

Human brain

NC_000943

NC_000943

*Isolated from the study

Phylogenetic analyses were performed by the neighbor-joining (NJ) method using Mega software with 1000 bootstrap replicates. To generate rooted trees, Murray Valley encephalitis virus (MVE) was used as an outgroup in the JEV phylogenetic analysis [11, 12].

Results

Distribution of mosquitoes

A total of 7 943 mosquitoes were collected from Linyi, Yongji, and Wangrong counties, Shanxi Province, from 17 to 22 August 2015, and consisted of six species from four genera (Table 3); Culex tritaeniorhynchus accounted for 73.08% (5 805/7 943), C. pipiens pallens for 24.75% (1 966/7 943), and Anopheles sinensis, Aedes vexans, Ae. dorsalis, and Armigers subalbatus for about 3% (104/7 943). C. tritaeniorhynchus was the dominant species in all counties, accounting for 70.81% (1 994/2 816), 77.03% (2 505/3 252), and 69.65% (1 306/1 875) of specimens from Linyi, Yongji, and Wangrong counties, respectively.
Table 3

Mosquitoes collected in Shanxi, China, 2015

Mosquito species

Collection sites

Total

Linyi

Yongji

Wanrong

 

No.

%

No.

%

No.

%

No.

%

Culex tritaeniorhynchus

1 994

70.81

2 505

77.03

1 306

69.65

5 805

73.08

C. pipiens pallens

765

27.17

704

21.65

497

26.51

1 966

24.75

Anopheles sinensis

57

2.02

3

0.09

44

2.35

104

1.31

Aedes vexans

0

0

35

1.08

0

0

35

0.44

Aedes dorsalis

0

0

5

0.15

0

0

5

0.06

Armigers subalbatus

0

0

0

0

28

1.49

28

0.35

Total

2 816

100

3 252

100

1 875

100

7 943

100

Molecular identification of mosquito-borne viruses

The mosquitoes were divided into 88 pools according to collection site, time, and species for homogenizing. RNA was extracted from 140 μl aliquots of clarified homogenates. The viral RNA was used as the template for RT-PCR using the seven mosquito-borne arbovirus primer sets listed in Table 1. The results are shown in Table 4. Among the 88 pools of mosquitoes, 16 were JEV-positive by RT-PCR amplification of the C/prM gene, among which 12 were C. tritaeniorhynchus and four were C. pipiens pallens. SXYC1546 and SXYC1548 specimens were JEV-positive by RT-PCR amplification of the JEV E gene. Sequence data for the E gene of SXYC1546 and SXYC1548 were deposited in GenBank. Among the 88 pools, 2 were positive for GETV using the 5′ UTR and NS1 gene primers. One SXYC1503 specimen (C. tritaeniorhynchus) was positive for both JEV and GETV at the same time. The collection site and mosquito species of positive specimens are listed in Table 4.
Table 4

Specimens positive for mosquito-borne virus genes in Shanxi, China, 2015 by RT-PCR amplifications

Collection site

Mosquito species

Sample title

viruses

No. Of each pool

The courtyards of farmer A’ households with pigsties

Culex tritaeniorhynchus

SXYC1537

JEV

100

The courtyards of farmer B’ households with pigsties

C. tritaeniorhynchus

SXYC1503

JEV/GETV

75

 

C. pipiens pallens

SXYC1523a

JEV

20

 

C. tritaeniorhynchus

SXYC1527

JEV

48

Pig farm A

C. tritaeniorhynchus

SXYC1542

JEV

100

 

C. tritaeniorhynchus

SXYC1562

JEV

100

Pig farm B

C. pipiens pallens

SXYC1530

JEV

100

 

C. tritaeniorhynchus

SXYC1546

JEV

100

 

C. tritaeniorhynchus

SXYC1548

JEV

100

 

C. tritaeniorhynchus

SXYC1549

JEV

100

 

C. tritaeniorhynchus

SXYC1551

GETV

100

 

C. tritaeniorhynchus

SXYC1553

JEV

100

 

C. tritaeniorhynchus

SXYC1555

JEV

100

The courtyards of farmer C’ households with pigsties

C. tritaeniorhynchus

SXYC1570

JEV

100

 

C. tritaeniorhynchus

SXYC1582

JEV

100

 

C. pipiens pallens

SXYC1586

JEV

100

 

C. pipiens pallens

SXYC1588

JEV

100

aVirus isolation obtained

1. Mosquitoes were collected from eight courtyards of farmers’ households (three with pigsties and five without pigsties) and two pig farms

2. The 16 pools of mosquito specimens positive for JEV were collected from the courtyards of three farmers’ households with pigsties (farmers A, B, and C) and two pig farms (pig farms A and B)

Virus isolation and identification

The clarified homogenates that were positive for JEV and GETV were inoculated onto BHK-21cells at a constant temperature, and CPE was observed under an optical microscope every 8 h. Among 17 pools of mosquitoes, only the SXYC1523 specimen isolated from C. pipiens pallens caused CPE in BHK-21 cells. Cells became round and shrank on day 3 after inoculation, CPE was up to 75% on day 4, and a large number of cells detached from the wall of the Nunc tube (Fig. 2). No obvious CPE was observed in other pools compared to control cells.
Fig. 2

Phase-contrast photomicrographs of control and infected BHK-21 cells. a Control cells. b Cells 4 days after infection with SXYC1523

Viral RNA was extracted from cell culture supernatant of SXYC1523 and RT-PCR was conducted with arbovirus gene primers. The cell supernatant was positive for JEV. Then 16 overlapping primers were used to amplify the complete open reading frame (ORF) of the SXYC1523 strain. The sequence of the ORF has been deposited in GenBank.

MIR of JEV in mosquitoes

Mosquito specimens were collected from the courtyards of eight farmers’ households and two pig farms in Linyi, Yongji, and Wangrong counties. Of 45 pools of mosquito specimens from the courtyards of three farmers’ households with pigsties (farmers A, B, and C) and two pig farms (pig farms A and B), 16 pools were positive for JEV in RT-PCR. The MIR of JEV from Culex, including C. tritaeniorhynchus and C. pipiens pallens, collected from three farmers’ households with pigsties was 7.39/1 000, and that from Culex collected from the two pig farms was 2.68/1 000. Thus, the virus carrier rate of JEV in mosquito specimens collected from the courtyards of farmers’ households with pigsties was as high or even higher than that from pig farms. Forty-three pools of mosquitoes collected from the courtyards of five farmers’ households without pigsties were negative for JEV (Table 5).
Table 5

Minimum infection rate (MIR) of JEV in mosquitoes in this study

Collection sites

Mosquito species

No. Individuals

No.pools

No. Positive Pools

MIR

(/1000)

The courtyards of farmers’ households with pigstiesa

Culex tritaeniorhynchus

723

8

5

6.92

 

C. pipiens pallens

360

5

3

8.3

 

Subtotal

1 083

13

8

7.39

Pig farmb

C.tritaeniorhynchus

2 433

26

7

2.88

 

C. pipiens pallens

552

6

1

1.81

 

Subtotal

2 985

32

8

2.68

The courtyards of farmers’ households without pigstiesc

C. tritaeniorhynchus

2 649

33

0

0

 

C. pipiens pallens

1 054

10

0

0

 

Subtotal

3 703

43

0

0

aCourtyards of three farmers’ households with pigsties (farmers A, B, and C shown in Table 4)

bTwo pig farms (pig farms A and B in Table 4)

cCourtyards of five farmers’ households without pigsties

Molecular characterization of mosquito-borne viruses

Phylogenetic analysis

To understand the molecular genetic characteristics of the JEV isolates obtained in the present study, we selected 39 JEV strains covering genotypes I–V isolated from different countries and different species of mosquitoes from GenBank to establish phylogenetic trees based on the E gene and ORF sequence together with the new isolates in this study. JEV was divided into five genotypes, and SXYC1523 isolated from C. pipiens pallens in Shanxi was located in the branch of genotype I (Fig. 3a). In phylogenetic analyses based on the E gene (Fig. 3b), SXYC1523, SXYC1546, and SXYC1548 derived from mosquitoes in Shanxi Province in 2015 were all located in the branch of genotype I.
Fig. 3

Phylogenetic analysis of JEV isolates. a Phylogenetic analysis based on ORF sequencing. b Phylogenetic analysis based on E gene sequencing. Scale bars indicate the number of nucleotide substitutions per site

JEV identity and variation in amino acid sequences

The levels of nucleotide and amino acid sequence identity of the JEV E gene were 99.5–100% and 100%, respectively, in three strains (SXYC1523, SXYC1546, SXYC1548). Comparison of the nucleotide and amino acid sequences of the E gene between SXYC1523 strain and 39 other strains used in phylogenetic analyses indicated a nucleotide identity ranging from 72.8% (XZ0934) to 98.7% (XJ69) and an amino acid identity ranging from 90.6% (XZ0934) to 100%. The nucleotide sequence identity of the E gene between SXYC1523 with genotype I JEV ranged from 96.3% (Ishikawa) to 98.7% (XJ69), and the amino acid sequence identity ranged from 98% (Ishikawa) to 100%. Amino acid sequence identity of the E protein between the SXYC1523 strain and local JE strains (12-YJ033, 12-LY039, 12-TJ022) isolated in 2012 was 100%.

The E protein is a major structural protein of JEV and is closely related to viral virulence. To analyze the key amino acids, we compared the E protein of strains isolated in this study (SXYC1523, SXYC1546, SXYC1548) to SA14-14-2, an attenuated vaccine strain, and other virulent strains (Table 6). The results suggested that eight key amino acid residues were not different in these three strains derived from mosquitoes collected in the areas with a high incidence of adult JE in this study, compared to JEV strains isolated from mosquitoes, porcine serum, or specimens from patients with encephalitis, regardless of genotype. These results suggest that the virulence of JEV circulating in these regions in 2015 has not changed.
Table 6

Comparison of key amino acid residues of the E protein related to neurovirulence of JEVa

Strain

E107

E138

E176

E177

E264

E279

E315

E439

SA-14-14-2 (GIII)

Phe(F)

Lys(K)

Val(V)

Ala(A)

His(H)

Met(M)

Val(V)

Arg(R)

SXYC1523b(GI)

Leu(L)

Glu(E)

Ile(I)

Thr(T)

Gln(Q)

Lys(K)

Ala(A)

Lys(K)

SXYC1546b(GI)

Leu(L)

Glu(E)

Ile(I)

Thr(T)

Gln(Q)

Lys(K)

Ala(A)

Lys(K)

SXYC1548b(GI)

Leu(L)

Glu(E)

Ile(I)

Thr(T)

Gln(Q)

Lys(K)

Ala(A)

Lys(K)

SX09S-01(GI)

Leu(L)

Glu(E)

Ile(I)

Thr(T)

Gln(Q)

Lys(K)

Ala(A)

Lys(K)

12-YJ033(GI)

Leu(L)

Glu(E)

Ile(I)

Thr(T)

Gln(Q)

Lys(K)

Ala(A)

Lys(K)

GZ56(GI)

Leu(L)

Glu(E)

Ile(I)

Thr(T)

Gln(Q)

Lys(K)

Ala(A)

Lys(K)

FU(GII)

Leu(L)

Glu(E)

Ile(I)

Thr(T)

Gln(Q)

Lys(K)

Ala(A)

Lys(K)

Nakayama(GIII)

Leu(L)

Glu(E)

Ile(I)

Thr(T)

Gln(Q)

Lys(K)

Ala(A)

Lys(K)

P3 (GIII)

Leu(L)

Glu(E)

Ile(I)

Thr(T)

Gln(Q)

Lys(K)

Ala(A)

Lys(K)

JKT6468(GIV)

Leu(L)

Glu(E)

Ile(I)

Thr(T)

Gln(Q)

Lys(K)

Ala(A)

Lys(K)

Muar(GV)

Leu(L)

Glu(E)

Ile(I)

Thr(T)

Gln(Q)

Lys(K)

Ala(A)

Lys(K)

XZ0934(GV)

Leu(L)

Glu(E)

Ile(I)

Thr(T)

Gln(Q)

Lys(K)

Ala(A)

Lys(K)

aThese eight aa residues of the E protein were shown to play a key role in neurovirulence. They are very different between the attenuated vaccine strain (SA14-14-2) and the virulent strains

bIsolated in Shanxi, 2015 in this study

Discussion

JE is mainly endemic to Asia [1, 2, 4]. The scope of JE prevalence, however, has been gradually expanding in recent years, and JE has already spread to northwest Australia and Guam in the Pacific region, where it has become an emerging arboviral disease [1719]. JEV is a mosquito-borne virus, and mosquitoes belonging to various genera, such as Culex, Anopheles, Armigeres, and Aedes, can all transmit it. Among these species, Culex, in particular C. tritaeniorhynchus, is the most important vector [19, 20]. The larvae of C. tritaeniorhynchus prefer to propagate in clean water, such as the water in rice fields, while the larvae of C. pipiens pallens generally propagate in sewage and the adults inhabit human dwellings. Therefore, it is easy for mosquitoes to propagate in rural areas with rich water resources, poor sanitation, and sewage [19, 20]. Pigs become infected with JEV via mosquito bites, and the virus is greatly amplified in pigs. This makes pigs, including both domestic and feral pigs, amplification hosts for local endemic JEV [1921]. The infected pigs may also be hosts for further spread of JEV by mosquito bites. Therefore, a short distance between dwelling places and pigsties or the habitats of feral pigs will increase the probability of exposure to JEV. Populations living in environments with high mosquito density and surrounded by pigsties will be prone to JEV infection [22].

Our results suggest that the dominant mosquito specie in Linyi, Yongji, and Wanrong counties of Shanxi Province is still C. tritaeniorhynchus, and the endemic JEVs belong to genotype I, consistent with most parts of China and Asia [23]. The eight key amino acid residues determining the virulence of JEV isolates in this study have not changed compared to previous strains and local strains isolated in 2012, suggesting that local endemic JEV shows high neurovirulence [24]. These results suggest that the dominant mosquito species, genotypes, and virulence of JEV have not changed in Linyi, Yongji, and Wanrong, where the incidence of adult JE has been continuously high. Hence, these regions are still natural endemic foci of JEV with persist risk of infection.

In this study, we collected mosquito specimens from the courtyards of eight farmers’ households and two pig farms. There were pigsties in the courtyards of three farmers’ households but not in those of the other five households. Five to ten pigs were raised in the pigsties in the courtyards, and these pigsties were close to human houses. In addition, chickens, ducks, geese, and other domestic animals were also raised in the courtyards at the same time. Therefore, there was a great deal of stagnant water polluted by the feces of various animals in the living environment, which provided an appropriate environment for mosquitoes to propagate. Eight of thirteen pools of mosquito specimens collected from the courtyards of the above three farmers’ households with pigsties were positive for JEV based on RT-PCR amplification of the C/PrM gene, and the MIR was 7.39/1 000, higher than that (2.68/1 000) of mosquitoes collected from pig farms (Table 5). For the other five courtyards of the farmers’ households without pigsties, their pigs were all raised in pig farms far away from villages (over 2–5 km). Although large numbers of C. tritaeniorhynchus and C. pipiens pallens were present in the above five courtyards, JEV was not detected from these mosquitoes. Therefore, it is clear that whether the mosquitoes carried JEV was directly related to the location of pigsties in the courtyards (Table 5). The transmission cycle of JEV was blocked due to the lack of amplification hosts in the above five courtyards without pigsties. In contrast, the presence of pigs in the other three courtyards with pigsties completed the circle of JEV transmission as mosquito (virus)–pig–mosquito (virus), which made JEV more active and resulted in large numbers of mosquitoes carrying the virus. This concept is supported by another example from South Korea. During 2010–2015, South Korea reported 129 JE cases, some of which lived close to pigsties [7]. In conclusion, the presence of pigsties close to human dwellings provides an amplification host for JEV, which leads to JEV proliferation in local areas and increases the risk of human infection with JEV.

Conclusion

A JE vaccine was included in the EPI in 2008 in China, and children can be inoculated with it free of charge; it has greatly reduced the incidence of JE cases among children in China [9, 22]. Adults were not inoculated with this vaccine in childhood (long before the implementation of EPI) and therefore are more susceptible to JEV infection [10]. In addition, the habit of farmers to raise pigs in their own courtyards increases the risk of infection with JEV. Therefore, in regions with high prevalence rates of adult JE, such as Linyi, Yongji, and Wanrong, it is necessary to implement JE vaccination and strengthen the management of local animal husbandry. Pigs should be raised intensively in pig farms far from human dwellings with implementation of modern management. Farmers should cease the practice of raising pigs in their own courtyards to reduce the risk of infection with JEV and further decrease the incidence of adult JE.

Abbreviations

BHK-21: 

Baby hamster kidney cell line

CPE: 

Cytopathic effect

DMEM: 

Dulbecco’s Modified Eagle’s Medium

EPI: 

The national Expanded Program of Immunization

FBS: 

Fetal bovine serum

GETV: 

Getah virus

JE: 

Japanese encephalitis

JEV: 

Japanese encephalitis virus

MIR: 

Minimum infection rate

MVE: 

Murray Valley encephalitis virus.

NJ: 

Neighbor-joining

ORF: 

Open reading frame

RT-PCR: 

Reverse transcription-polymerase chain reaction

Declarations

Acknowledgements

We thank the staff of the Shanxi Center for Disease Control and Prevention for assistance with collection of mosquito samples. We also thank the National Natural Science Foundation of China for financially supporting this research.

Funding

This work was supported by grants from National Natural Science Foundation of China (81290342 and 81501757), and Development Grant of State Key Laboratory of Infectious Disease Prevention and Control (2014SKLID103). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Availability of data and materials

The sequence of JEV strains in this study has been deposited in GenBank. The JE data used in this study were obtained from the China Information System for Diseases Control and Prevention (available at http://www.phsciencedata.cn/Share/index.jsp).

Authors’ contributions

XR, SF, PD contributed equally to this work. They collected the mosquitoes, did the experiments and wrote the manuscript. HW conceived and guided the experiment. XL and XG made the picture and performed the data analysis. YL, WL, YH and ZL did some experiments. JC collected the mosquitoes. GW and GL participated in the whole process and modified the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

The study did not use patient’s medical records and all data were analyzed anonymously.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Immunology and Microbiology, Shanxi Medical University
(2)
State Key Laboratory of Infectious Disease Prevention and Control, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention
(3)
Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases
(4)
Shanxi Center for Disease Control and Prevention

References

  1. Lindenbach BD, Thiel HJ, Rice CM. Flavivirdae :the viruses and their replication. In: Knipe DM, Howley PM, editors. Wolter KluwerLippincott Willian&Wikins. 5th ed. Philadephia: Academic; 2007. p. 1102–53.Google Scholar
  2. Halstead SB, Jacobson J. Japanese encephalitis vaccines. In: Plotkin SA, Orenstein WA, Offit PA, editors. Vaccines. 5th ed. Philadelphia: Elsevier; 2008. p. 311–52.Google Scholar
  3. Erlanger TE, Weiss S, Keiser J, Utzinger J, Wiedenmayer K. Past, present, and future of Japanese encephalitis. Emerg Infect Dis. 2009;15(1):1–7.View ArticlePubMedPubMed CentralGoogle Scholar
  4. Campbell GL, Hills SL, Fischer M, Jacobson JA, Hoke CH, Hombach JM, Marfin AA, Solomon T, Tsai TF, Tsu VD, Ginsburg AS. Estimated global incidence of Japanese encephalitis: a systematic review. Bull World Health Organ. 2011;89(10):766–74. doi:10.2471/BLT.10.085233. 774A-774E.View ArticlePubMedPubMed CentralGoogle Scholar
  5. Wang LH, Fu SH, Wang HY, Liang XF. Japanese encephalitis outbreak,Yuncheng,China. Emerg Infec Dis. 2007;13(7):1123–5.View ArticleGoogle Scholar
  6. Vashishtha VM, Ramachandran VG. Vaccination policy for Japanese encephalitis in India: Tread with caution! Indian Pediatr. 2015;52(10):837–9.View ArticlePubMedGoogle Scholar
  7. Gao XY, Nasci R, Liang GD. The neglected arboviral infections in mainland China. PLoS Negl Trop Dis. 2010;4(4):e624. doi:10.1371/journal.pntd.0000624.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Gao XY, Li XL, Li MH, Fu SH, Wang HY, Lv Z, et al. Vaccine Strategies for the Control and Prevention of Japanese Encephalitis in Mainland China, 1951–2011. PLoS Negl Trop Dis. 2014;8(8):e3015. doi:10.1371/journal.pntd.0003015.View ArticlePubMedPubMed CentralGoogle Scholar
  9. Zheng YY, Li MH, Wang HY, Liang GD. Japanese encephalitis and Japanese encephalitis virus in mainland China. Rev Med Virol. 2012;22:301–22.View ArticlePubMedGoogle Scholar
  10. Li X, Cui S, Gao X, Wang H, Song M, Li M, et al. The Spatio-temporal Distribution of Japanese Encephalitis Cases in Different Age Groups in Mainland China, 2004–2014. PLoS Negl Trop Dis. 2016;10(4):e0004611. doi:10.1371/journal.pntd.0004611.View ArticlePubMedPubMed CentralGoogle Scholar
  11. Wang J, Zhang H, Sun X, Fu S, Wang H, Feng Y, Wang H, Tang Q, Liang GD. Distribution of mosquitoes and mosquito-borne arboviruses in Yunnan Province near the China-Myanmar-Laos border. Am J Trop Med Hyg. 2011;84(5):738–46.View ArticlePubMedPubMed CentralGoogle Scholar
  12. Sun X, Fu S, Gong Z, Ge J, Meng W, Feng Y, Wang J, Zhai Y, Wang H, Nasci R, Wang H, Tang Q, Liang G. Distribution of arboviruses and mosquitoes in northwestern Yunnan Province, China. Vector Borne Zoonotic Dis. 2009;9(6):623–30.View ArticlePubMedGoogle Scholar
  13. Kuno G, Mitchell CJ, Chang GJ, Smith GC. Detecting bunyaviruses of the Bunyamwera and California serogroups by a PCR technique. J Clin Microbiol. 1996;34(5):1184–8.PubMedPubMed CentralGoogle Scholar
  14. Lv X, Mohd Jaafar F, Sun X, et al. Isolates of Liao Ning Virus from Wild-Caught Mosquitoes in the Xinjiang Province of China in 2005. PLoS One. 2012;7(5):e37732. doi:10.1371/journal.pone.0037732.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Zhai YG, Wang HY, Sun XH, Fu SH, Wang HQ, Attoui H. Complete sequence characterization of isolates of Getah virus (genus Alphavirus, family Togaviridae) from China. J Gen Virol. 2008;89(Pt 6):1446–56. doi:10.1099/vir.0.83607-0.View ArticlePubMedGoogle Scholar
  16. Feng Y, Fu S, Zhang H, Li M, Zhou T, Wang J, Zhang Y, Wang H, Tang Q, Liang G. Distribution of mosquitoes and mosquito-borne viruses along the China-Myanmar border in Yunnan Province. Jpn J Infect Dis. 2012;65(3):215–21.View ArticlePubMedGoogle Scholar
  17. Mackenzie JS, Gubler DJ, Petersen LR. Emerging flaviviruses: the spread and re- surgence of Japanese encephalitis, WestNile and dengue viruses. Nat Med. 2004;10(12 Suppl):S98–S109.View ArticlePubMedGoogle Scholar
  18. Weaver SC, Reisen WK. Present and future arboviral threats. Antiviral Res. 2010;85:328–45.View ArticlePubMedGoogle Scholar
  19. Mackenzie JS, Williams DT, Smith DW. Japanese encephalitis virus: the geo-graphic distribution, incidence, and spread of a virus with a propensity to emerge in new areas. In: Tabor E, editor. Emerging Virusin Human Populations. Amsterdam: Elsevier BV; 2007. p. 201–68.Google Scholar
  20. van den Hurk AF, Ritchie SA, Mackenzie JS. Ecology and geographical expansion of Japanese encephalitis virus. Annu Rev Entomol. 2009;54:17–35. doi:10.1146/annurev.ento.54.110807.090510.View ArticlePubMedGoogle Scholar
  21. Le Flohic G, Porphyre V, Barbazan P, Gonzalez JP. Review of climate, landscape, and viral geneticsas drivers of the Japanese encephalitis virus ecology. PLoS Negl Trop Dis. 2013;7(9):e2208. doi:10.1371/journal.pntd.0002208.View ArticlePubMedPubMed CentralGoogle Scholar
  22. Solomon T. Control of Japanese encephalitis—within our grasp? N Engl J Med. 2006;355(9):869–71.View ArticlePubMedGoogle Scholar
  23. Pan XL, Liu H, Wang HY, Fu SH, Liu HZ, Zhang HL, Li MH, Gao XY, Wang JL, Sun XH, Lu XJ, Zhai YG, Meng WS, He Y, Wang HQ, Han N, Wei B, Wu YG, Feng Y, Yang DJ, Wang LH, Tang Q, Xia G, Kurane I, Rayner S, Liang GD. Emergence of genotype I of Japanese encephalitis virus as the dominant genotype in Asia. J Virol. 2011;85(19):9847–53.View ArticlePubMedPubMed CentralGoogle Scholar
  24. Zheng Y, Cao Y, Fu S, Cheng J, Zhao J, Dai P, Kong X, Liang G. Isolation and identification of mosquito-borne arboviruses in Yuncheng City, Shanxi Province, 2012. Chin J Epidemiol. 2015;36(4):368–73 (in Chinese).Google Scholar

Copyright

© The Author(s). 2017

Advertisement