Skip to main content

Table 2 The PCR primers used for quantitative and RT-PCR analyses

From: In vitro gene silencing of independent phosphoglycerate mutase (iPGM) in the filarial parasite Brugia malayi

Target Gene Primer name Primers (5-3)
Bm-ipgm Bm-ipgm F 5 GCT GAT AAG GTG ATT GAG 3
Bm-ipgm R 5 CAG TTA CCA TCA GTA TGT AG 3
Bm-tub-1 Bm-tub F 5 ACT TGG TGT CCG AAT ATC3
Bm-tub R 5ACTCTTCCTGTTCAATGTAT3