Skip to main content

Advertisement

Table 1 Oligonucleotide primers used for the PCR-based identification of the fungal isolate and Wolbachia

From: Molecular evidence on the occurrence of co-infection with Pichia guilliermondii and Wuchereria bancrofti in two filarial endemic districts of India

Gene Oligonucleotide sequence Source/Reference
Filaria-specific 28S rRNA (BD1A) Forward: 5′ATGAAAGGCGTTGATATATAG3′ Gayen et al., [22]
Reverse: 5′GCAAGCCATGCAAGCGTTGAG3′
Wolbachia 16S rRNA-specific Forward (FIL-5): 5′ TGAGGAAGATAATGACGG3′ Smith and Rajan, 2000 [25]
Reverse (FIL-6): 5′CCTCTATCCTCTTTCAACC3′
WSP int Forward: 5′TAGCTTACTACATTCGCTTGCA3′ Bazzocchi et al., 2000 [26]
Reverse: 5′CCAACTAGTGCCTATAAAGAAC3′
26 s rDNA Forward (NL1): 5′GCATATCAATAAGCGGAGGAAAAG3′ O’Donnell, 1993 [27]
Reverse (NL4): 5′GGTCCGTGTTTCAAGACGG3′
RPS0 Forward: 5′CTTGGGTTCCAAGAACGTGATT3′ Martinez et al., [24]
Reverse: 5′CTTCAGCATTCCTCAGCCTTGGA3′