Skip to main content

Advertisement

Table 1 Primers used for identification in this studya

From: Pigsties near dwellings as a potential risk factor for the prevalence of Japanese encephalitis virus in adult in Shanxi, China

Primers Sequence of primers (5′–3′) Amplify region Length of product (reference)
Flavivius
 FU1 TACCACATGATGGGAAAGAGAGAGAA NS5 310 [11]
 CFD2 GTGTCCCAGCCGGCGGTGTCATCAGC
Alphavirus
 M2W YAGAGCDTTTTCGCAYSTRGCHW NS1 434/310 [11]
 cM3W ACATRAANKGNGTNGTRTCRAANCCDAYCC
 M2W2 TGYCCNVTGMDNWSYVCNGARGAYCC
Bunyaviruses
 BUP ATGACTGAGTTGGAGTTTGATGTCGC S 251 [13]
 BDW TGTTCCTGTTGCCAGGAAAAT
BAV S12 gene primers
 BAV-12-854-S AAATTGATAGYGYTTGCGTAAGAC S12 850 [11]
 BAV-12-B2-R GTTCTAAATTGGATACGGCGTGC
LNV S12 gene primers
 LNV12s1 CACTGGCTCCGGCTGTAGTAACAG S12 435 [14]
 LNV12r1 CTGTTCGGATCATCTGGAATTTGA
GETV 5′UTR and NS1 gene primers
 F1 ATGGCGGACGTGTGACATCAC 5′UTR,NS1 930 [15]
 R1 GTAACCTTCGCATGACACCACC
JEV C/PrM gene primers
 JE-251 F CGTTCTTCAAGTTTACAGCATTAGC C/PrM 674/492 [5]
 JE-925R CCYRTGTTYCTGCCAAGCATCCAMCC
 JE-743R CGYTTGGAATGYCTRGTCCG
  1. F, Forward primer; R, Reverse primer; M, C/A; W, A/T; Y, C/T; K, G/T; R, G/A; V, G/A/C; D, T/A/G; BAV, Bannan virus; LNV, Liaoning virus; GETV, Getach virus; JEV, Japanese encephalitis virus
  2. a The primers used to amplify the complete open reading frame (ORF) nucleotide sequence and envelope gene of the viral genomic RNA were all from a previous study [23]