Skip to main content

Table 1 Primers used in this study

From: Identification of tick-borne pathogen diversity by metagenomic analysis in Haemaphysalis longicornis from Xinyang, China

Target Gene Primer Primer name
Anaplasma 16S rRNA Out1 TTGAGAGTTTGATCCTGGCTCAGAACG
Out2(21) CACCTCTACACTAGGAATTCCGCTATC
Out2F GATAGCGGAATTCCTAGTGTAGAGGTG
317Pan(20) AAAGGAGGTAATCCAGC
Rickettsia gltA CS2d ATGACCAATGAAAATAATAAT
CSEndr CTTATACTCTCTATGTACA
RpCS877F GGGGACCTGCTCACGGCGG
RpCS1258R(20) ATTGCAAAAAGTACAGTGAACA
Coxiella transposase Cox_trans-3 GTAACGATGCGCAGGCGAT
Cox_trans-4(23) CCACCGCTTCGCTCGCTA
Babesia 18S rDNA Piro0F GCCAGTAGTCATATGCTTGTGTTA
Piro1F CCATGCATGTCTWAGTAYAARCTTTTA
Piro5.5R CCTYTAAGTGATAAGGTTCACAAAACTT
Piro6R(22) CTCCTTCCTYTAAGTGATAAGGTTCAC
SFTSV S segment BNYS1-F TCTTCTCCATCAAGAACAGC
BNYS1-R(24) TTCGACAAAATTAGACCTCC