Skip to main content

Table 1 Details of the multiplex qPCR primers and the probes used in the study

From: Co-parasitism of intestinal protozoa and Schistosoma japonicum in a rural community in the Philippines

Parasite Gene target GenBank Accession # Reference Primer / probe Sequence (5′ → 3′) Product size (bp) Final concentration (nmol/L)
Blastocystis spp. SSU rRNA AY244621 [41] Forward primer GGTCCGGTGAACACTTTGGATTT 119 350
Reverse primer CCTACGGAAACCTTGTTACGACTTCA   350
Probe FAM-TCGTGTAAATCTTACCATTTAGAGGA-MGBNFQ   120
Entamoeba histolytica SSU rRNA X75434.1 [30, 71] Forward primer AACAGTAATAGTTTCTTTGGTTAGTAAAA 135 200
Reverse primer CTTAGAATGTCATTTCTCAATTCAT   200
Probe ROX-ATTAGTACAAAATGGCCAATTCATTCA-IBRQ   80
Giardia duodenalis SSU rRNA M54878.1 [30] Forward primer GACGGCTCAGGACAACGGTT 63 200
Reverse primer TTGCCAGCGGTGTCCG   200
Probe CY5-CCCGCGGCGGTCCCTGCTAG-IBRQ   100
Cryptosporidium spp. COWP AF248743.1 [30] Forward primer CAAATTGATACCGTTTGTCCTTCTG 150 300
Reverse primer GGCATGTCGATTCTAATTCAGCT   300
Probe HEX-TGCCATACATTGTTGTCCTGACAAATTGAAT-IBFQ   75
  1. SSU rRNA Small subunit ribosomal RNA, COWP Cryptosporidium oocyst wall protein