Skip to main content

Table 1 Primers used for PCR for the identification of tick species and detection and of Anaplasma spp. in the ticks from Qinghai

From: Molecular detection of Anaplasma infections in ixodid ticks from the Qinghai-Tibet Plateau

Target species Target gene Primer(5′ → 3′) Annealing temperature (°C) No. of cycles Expected size (bp) References
Anaplasma spp. 16S rRNA EE1: TCCTGGCTCAGAACGAACGCTGGCGGC
EE2: AGTCACTGACCCAACCTTAAATGGCTG
55 35 1400 [37]
A. bovis 16S rRNA AB1f: CTCGTAGCTTGCTATGAGAAC
AB1r: TCTCCCGGACTCCAGTCTG
55 35 551 [26]
A. phagocytophilum 16S rRNA SSAP2f: GCTGAATGTGGGGATAATTTAT
SSAP2r: ATGGCTGCTTCCTTTCGGTTA
55 35 641 [26]
A. marginale msp4 Amargmsp4F: CTGAAGGGGGAGTAATGGG
Amargmsp4R: GGTAATAGCTGCCAGAGATTC
60 30 344 [38]
A. ovis msp4 MSP43: CCGGATCCTTAGCTGAACAGAATCTTGC
MSP45: GGGAGCTCCTATGAATTACAGAGAATTGTTTAC
60 35 869 [39]
A. capra gltA gltAouterF: GCGATTTTAGAGTGYGGAGATTG
gltAouterR: TACAATACCGGAGTAAAAGTCA
55 35 1031 [1]
  gltAinnerF: GCGATTTTAGAGTGYGGAGATTG
gltAinnerR: GCGATTTTAGAGTGYGGAGATTG
60 35 594  
16S rRNA Forward: GCAAGTCGAACGGACCAAATCTGT
Reverse: CCACGATTACTAGCGATTCCGACTTC
58 35 1261 [35]
groEL Forward: TGAAGAGCATCAAACCCGAAG
Reverse: CTGCTCGTGATGCTATCGG
55 35 874 [35]
Tick 16S rRNA 16SrRNA-F: CTGCTCAATGATTTTTTAAATTGCTGTGG
16SrRNA-R: CCGGTCTGAACTCAGATCAAGT
55 35 450 Designed for this study