Skip to main content

Advertisement

Table 1 Primers used to amplify the mitochondrial 16S rRNA, COI genes and the nuclear ribosomal 28S rRNA gene

From: Taxonomic integrative and phylogenetic identification of the first recorded Triatoma rubrofasciata in Zhangzhou, Fujian Province and Maoming, Guangdong Province, China

Gene target Forward primer (5′ → 3′) Reverse primer (5′ → 3′) Expected length (bp)
16S rRNA GGTTTTGAATGGCCGCAGTA TCTCCGGTTTGAACTCAGATCA 491
28S rRNA GCGAGTCGTGTTGCTTGATAGTGCAG TTGGTCCGTGTTTCAAGACGGG 678
COI TGTAGAAAGAGGAGCGGGAA TCCGGTTTCCATGGCAATAA 439