Skip to main content

Table 3 Primers designed for detection of Echinococcus granulosus s. s., E. multilocularis and E. canadensis in the study

From: A multiplex PCR for differential detection of Echinococcus granulosus sensu stricto, Echinococcus multilocularis and Echinococcus canadensis in China

Targeted species Primer name Sequences (5′ → 3′) Expected product length Final concentration (nmol/L)
E. granulosus s. s. g/f GTCTGTGTTTCTTACCATTG 811 200
g/r GACCCGTACAAACATATATCAAC
E. multilocularis m/f TTGTTCTTTGTGTTACTGTAGG 457 600
m/r CTATACAGACATTGATTACCATAA
E. canadensis c/f GTAAGTCTAAGTTGGTTATTATTCAC 315 200
c/r CTTATTAAACAACACAAAAATACTAAATG