Skip to main content

Table 1 Primer sequences of EgTPX, EgEPC1 and Eg HSP70

From: Efficacy of radiotherapy for the treatment of cystic echinococcosis in naturally infected sheep

Genes Primers (5’-3’) Product size
EgTPX Forward: TTTCTTAGATAAGCTCGACTCCAA
Reverse: AGTATATAGACCGGTGAATTAAGGG
196bp
EgHSP70 Forward: GAGGAGTTGTGTTCGGACCT
Reverse: GTCCGGGTTTATCGACTTGT
145bp
EgEPC1 Forward: TTTCTTAGATAAGCTCGACTCCAA
Reverse: AGTATATAGACCGGTGAATTAAGGG
151bp
Caspase-3 Forward: CTTTGCTTGCGTCATCCTTA
Reverse: GGCAGGCCTGAATAAAGAAC
152bp
Gadd45 Forward: TGGAATGCGCTCTACTATCG
Reverse: GCCATGGCCTTGATAAAGAT
165bp
actin Forward: TCAATCCTAAAGCCAATC
Reverse: CGTACAACGACAGCAC
163bp