Skip to main content

Table 2 Primer sets with sequences for amplification of cytochrome oxidase I (COI) and 16S rRNA

From: Morphological and molecular characterization of invasive Biomphalaria straminea in southern China

Primer name Region Sequence (5′ → 3′) Annealing temperature (°C)
LCO1490 COI (sense) GGTCAACAAATCATAAAGATATTGG 45
HCO2198 COI (antisense) TAAACTTCAGGGTGACCAAAAAATCA 45
16arm 16S rRNA (sense) CTTCTCGACTGTTTATCAAAAACA 50
16brm 16S rRNA (antisense) GCCGGTCTGAACTCAGATCAT 50