Skip to main content

Table 1 Primers used to amplify the mitochondrial 16S rRNA, cytochrome c oxidase subunit I (COI) gene and nuclear ribosomal 18S and 28S rRNA genes

From: Identification and characterization of the causative triatomine bugs of anaphylactic shock in Zhanjiang, China

Gene target Forward primer (5’→3’) Reverse primer (5’→3’) Expected length (bp)
16S rRNA CGCCTGTTTATCAAAAACAT [15] CTCCGGTTTGAACTCAGATCA [15] 552
28S rRNA GCGAGTCGTGTTGCTTGATAGTGCAG [16] TTGGTCCGTGTTTCAAGACGGG [16] 710
COI CCTGCAGGAGGAGGAGAYCC [17] TAAGCGTCTGGGTAGTCTGARTAKCG [17] 650
18S rRNA-1a TGGTTGATCCTGCCAGTAGTC TCGACACTCGTTTAAGAGCACC 822
18S rRNA-2a TGTTGCGGTTAAAAAGCTCG TCGGAATTAACCAGACAAATCG 803
18S rRNA-3a AGGTTCGAAGGCGATCAGATAC TCCTTCCGCAGGTTCACCTA 829
  1. adesigned for this study