Skip to main content

Table 1 Primers designed for multiplex PCRs and sequencing

From: Accuracy of a reverse dot blot hybridization assay for simultaneous detection of the resistance of four anti-tuberculosis drugs in Mycobacterium tuberculosis isolated from China

DrugGenePrimerSequence (5′ → 3′)Amplicon size (bp)
RIFrpoBrpoB-FGGTCGCCGCGATCAAGGAGT228
  rpoB-RGAGCCGATCAGACCGATGTT 
INHkatGkatG-FCAGATGGGCTTGGGCTGGAA152
  katG-RTTCGTCAGCTCCCACTCGTAGC 
 inhAinhA-FTGGTCGAAGTGTGCTGAGTC193
  inhA-RTCCGGTAACCAGGACTGAAC 
 oxyR-ahpCoxyR-ahpC-FGCAGTCACAACAAAGTCAGCTCTG401
  oxyR-ahpC-RACAGGTCACCGCCGATGAGA 
SMrpsLrpsL-FTTGTGGTTGCTCGTGCCTG635
  rpsL-FCAACTGCGATCCGTAGACCG 
 rrsrrs-RCTCTCGGATTGACGGTAGGTGG540
  rrs-FGCGTCCTGTGCATGTCAAACC 
EMBembBembB-FCGTGGTGATATTCGGCTTCCTG493
  embB-RCTGCACACCCAGTGTGAATGCG 
  1. RIF Rifampicin, INH Isoniazid, SM Streptomycin, EMB Ethambutol