Skip to main content

Table 1 Primer sequences and PCR conditions for pfhrp2 and pfldh genes amplification

From: Prevalence of Plasmodium falciparum isolates lacking the histidine rich protein 2 gene among symptomatic malaria patients in Kwilu Province of the Democratic Republic of Congo

Targeted gene Primer sequence (5′ → 3′) Reaction component Cycling condition LOD
(ng/µl)
pfhrp2 Exon 1–2, PF3D7_0831800 Outer
For: GGTTTCCTTCTCAAAAAATAAAG
Rev: TCTACATGTGCTTGAGTTTCG
One Taq 2 × Master Mix with standard buffer: 12.5 µl
10 µmol/L forward primer: 1 µl
10 µmol/L reverse primer: 1 µl
Nuclease free water: 7.5 µl
DNA template: 3 µl (gDNA or 5 × diluted outer PCR product
25 µl reaction volume
95 °C/5 min;
40 cycles of 95 °C/30 s, 55 °C/30 s, 68 °C/30 s
68 °C/5 min
4 °C–∞
10–5
Inner
For: GTATTATCCGCTGCCGTTTTTGCC
Rev: CTACACAAGTTATTATTAAATGCGGAA
95 °C/5 min;
40 cycles of 95 °C/30 s, 62 °C/30 s, 68 °C/30 s
68 °C/5 min
4 °C–∞
pfldh (qPCR) For: ACGATTTGGCTGGAGCAG
Rev: GGAACACCTGAATGTTGATG
PowerUp™ SYBR ™ Green Master Mix (2 ×): 12.5 µl
10 µmol/L forward primer: 0.5 µl
10 µmol/L reverse primer: 0.5 µl
Nuclease free water: 6.5 µl
DNA template: 2–4 µl
22–24 µl reaction volume
50 °C/2 min;
95 °C/2 min
45 cycles of 95 °C/15 s, 62 °C/1 min, 95 °C/30 s, 60 °C/15 s
10–4
  1. LOD Lower limit of detection, qPCR Quantitative or real-time PCR