Prevalence of Plasmodium falciparum isolates lacking the histidine rich protein 2 gene among symptomatic malaria patients in Kwilu Province of the Democratic Republic of Congo

Table 1 Primer sequences and PCR conditions for pfhrp2 and pfldh genes amplification

Targeted gene	Primer sequence (5′ → 3′)	Reaction component	Cycling condition	LOD (ng/µl)
pfhrp2 Exon 1–2, PF3D7_0831800	Outer For: GGTTTCCTTCTCAAAAAATAAAG Rev: TCTACATGTGCTTGAGTTTCG	One Taq 2 × Master Mix with standard buffer: 12.5 µl 10 µmol/L forward primer: 1 µl 10 µmol/L reverse primer: 1 µl Nuclease free water: 7.5 µl DNA template: 3 µl (gDNA or 5 × diluted outer PCR product 25 µl reaction volume	95 °C/5 min; 40 cycles of 95 °C/30 s, 55 °C/30 s, 68 °C/30 s 68 °C/5 min 4 °C–∞	10^–5
pfhrp2 Exon 1–2, PF3D7_0831800	Inner For: GTATTATCCGCTGCCGTTTTTGCC Rev: CTACACAAGTTATTATTAAATGCGGAA		95 °C/5 min; 40 cycles of 95 °C/30 s, 62 °C/30 s, 68 °C/30 s 68 °C/5 min 4 °C–∞	10^–5
pfldh (qPCR)	For: ACGATTTGGCTGGAGCAG Rev: GGAACACCTGAATGTTGATG	PowerUp™ SYBR ™ Green Master Mix (2 ×): 12.5 µl 10 µmol/L forward primer: 0.5 µl 10 µmol/L reverse primer: 0.5 µl Nuclease free water: 6.5 µl DNA template: 2–4 µl 22–24 µl reaction volume	50 °C/2 min; 95 °C/2 min 45 cycles of 95 °C/15 s, 62 °C/1 min, 95 °C/30 s, 60 °C/15 s	10^–4

ISSN: 2049-9957