Infection of sheep by Echinococcus multilocularis in Gansu, China: evidence from mitochondrial and nuclear DNA analysis

Table 3 Primers for PCR amplification for nuclear genes of Echinococcus multilocularis with positions based on reference sequences (FN567985, FN568375)

Gene	Primer name	Primer sequence (5′–3′)	Length	Position	Size (bp)	References
elp-exons VII and VIII	Elp7/8-F	GACTAAGTTTCACTAAGCTCTA	22	2566–2587	636	[25]
elp-exons VII and VIII	Elp7/8-R	GCTTCCAAGCTAAATCTGCGTAC	23	3201–3179	636	[25]
elp-exon IX	Elp9-F	TTGCATCAATGAATCGGTATTA	22	3934–3955	325	[25]
elp-exon IX	Elp9-R	CCGCTCTCGAATACTTTAATGGC	23	4258–4236	325	[25]
pepck	Pepck-F	AGCAAGGCCGAAGCCGATAAGA	22	6–27	1606	This study
pepck	Pepck-R	GCAAAACGACCATGACTATCCA	22	1611–1590	1606	This study
ef1-α	Ef1a-F	CTGGTAAATCGACTTCCACGGG	22	5–26	1320	This study
ef1-α	Ef1a-R	GCCTTGGCTTCCTTATCCTTGA	22	1324–1303	1320	This study

ef1-α elongation factor-1 alpha gene, elp ezrin–radixin–moesin (ERM)-like protein, pepck Phosphoenolpyruvate carboxykinase

ISSN: 2049-9957