Skip to content

Advertisement

  • Short Report
  • Open Access

Molecular detection of Anaplasma infections in ixodid ticks from the Qinghai-Tibet Plateau

  • 1, 2,
  • 1,
  • 1,
  • 1,
  • 1,
  • 2,
  • 1,
  • 1,
  • 1, 3Email author and
  • 1Email author
Infectious Diseases of Poverty20198:12

https://doi.org/10.1186/s40249-019-0522-z

  • Received: 23 June 2018
  • Accepted: 22 January 2019
  • Published:

Abstract

Anaplasma species are tick-transmitted obligate intracellular bacteria that infect many wild and domestic animals and humans. The prevalence of Anaplasma spp. in ixodid ticks of Qinghai Province is poorly understood. In this study, a total of 1104 questing adult ticks were investigated for the infection of Anaplasma species. As a result, we demonstrated the total infection rates of 3.1, 11.1, 5.6, and 4.5% for A. phagocytophilum, A. bovis, A. ovis and A. capra, respectively. All of the tick samples were negative for A. marginale. The positive rates of A. phagocytophilum, A. ovis and A. capra in different tick species were significantly different. The positive rates of A. capra and A. bovis in the male ticks were significantly higher than that in the female ticks. Sequence analysis of A. ovis showed 99.5–100% identity to the previous reported isolates. The sequences of A. phagocytophilum had 100% identity to strains Ap-SHX21, JC3–3 and ZAM dog-181 from sheep, Mongolian gazelles, and dogs. Two genotypes of A. capra were found based on 16S rRNA, citrate synthase (gltA) gene and heat shock protein (groEL) gene analysis. In conclusion, A. bovis, A. ovis, A. phagocytophilum, and A. capra were present in the ticks in Qinghai Province. Anaplasma infection is associated with tick species, gender and distribution. These data will be helpful for understanding prevalence status of Anaplasma infections in ticks in Qinghai-Tibet Plateau.

Keywords

  • Anaplasma
  • Tick
  • Sequence analysis
  • Prevalence

Multilingual abstracts

Please see Additional file 1 for translations of the abstract into the five official working languages of the United Nations.

Background

Ticks are important vectors of many viral, bacterial, and protozoal pathogens that infect to humans and animals, and tick species are widely distributed all over the world. Among tick-borne pathogens, the genus Anaplasma (order Rickettsiales, family Anaplasmataceae) is composed of tick-transmitted obligate intracellular bacteria, which include A. ovis, A. bovis, A. marginale, A. phagocytophilum, A. platys, A. centrale and A. capra [1, 2]. A. ovis is an obligate intra-erythrocytic organism of small ruminants. A. centrale has relatively mild virulence and it has been used as a live vaccine against A. marginale infection in several countries [3]. A. bovis infects monocytes of small mammals and ruminants [4, 5]. A. phagocytophilum infects neutrophils of many wild and domestic animals and humans, is the etiological agent of human granulocytic anaplasmosis and tick-borne fever [6]. A. platys is unique in infecting the platelets of dogs and it is the etiological agent of the infectious canine cyclic thrombocytopenia [7]. A. capra has been identified in China as a novel tick-transmitted zoonotic pathogen but its vectors and infected cell types are unclear [1]. Ixodid ticks play a critical role in the transmission and maintenance of Anaplasma species [8]. Dermacentor nuttalli, Hyalomma asiaticum and Rhipicephalus pumilio are the main vectors of A. ovis in China [9]. Although ixodid tick infestation of livestock is common, little is known about the Anaplasma infection in the ticks in Qinghai Province.

Qinghai Province is located in the northeastern part of Qinghai-Tibet Plateau in western China. Qinghai has an average attitude of more than 3000 m with 54% of the total area being between 4000 m and 5000 m. The provincial climate is characterized by being relatively arid, windy, and cold. Qinghai contains significant amounts of pastures and is an important region for animal production. Qinghai has 33.45 million ha of grassland. The grassland meadows are classified as alpine, swamp, Gobi, forest, and prairie. Yaks, Tibetan sheep, sheep and goats are adapted for survival and growth on these grasslands. Ixodid ticks infestation of livestock is often found in Qinghai Province, including 54.5, 24.0, 36.1% infection rates of A. ovis in sheep [10], Babesia spp. in wild yaks [11], and Theileria spp. in yaks [12], respectively. However, very little is known about the Anaplasma infection in animals and ticks. In this study, we identified and analyzed the infections of A. phagocytophilum, A. bovis, A. ovis, A. marginale and A. capra in ticks. The data provide an overview of Anaplasma infections and the potential threats to both livestock and humans in the study areas.

Methods

Sampling sites and tick collection

Samples were collected in the Qinghai Province, the Qinghai-Tibetan Plateau at an average altitude of > 3000 m. From February to October in 2015–2017, a total of 1104 questing adult ticks were collected from vegetation on 22 counties of Qinghai by using the flagging method. All of the tick specimens were identified according to morphological criteria [13] and a few were confirmed by sequence analysis of a partial fragment of the 16S rRNA gene.

DNA extraction, PCR amplification and sequencing

DNA extraction of each individual ticks was conducted as described previously [2]. DNA samples were detected for the presence of the agents in the genus Anaplasma by PCR targeting the msp4 gene for A. ovis and A. marginale, the 16S rRNA gene for A. phagocytophilum and A. bovis, and the citrate synthase (gltA) gene for A. capra, respectively. For further confirmation of the A. capra, the 16S rRNA gene and the heat-shock protein gene (groEL) were amplified from A. capra positive samples. The 16S rRNA gene was amplified for the molecular identification of the tick species. The PCR was carried out by using an automatic thermocycler (Bio-Rad, Hercules, USA). The reaction system for the PCRs was the same as described in our previous study [14] and the PCR primers and cycling conditions were shown in Table 1. The DNAs extracted from the animals infected with A. ovis, A. marginale, A. phagocytophilum, A. bovis and A. capra were used as positive controls, and double distilled water was used as a negative controls. The PCR products were visualized under UV illumination in a 1.2% agarose gel followed by electrophoresis and treated with GoldView I (Solarbio, Beijing, China).
Table 1

Primers used for PCR for the identification of tick species and detection and of Anaplasma spp. in the ticks from Qinghai

Target species

Target gene

Primer(5′ → 3′)

Annealing temperature (°C)

No. of cycles

Expected size (bp)

References

Anaplasma spp.

16S rRNA

EE1: TCCTGGCTCAGAACGAACGCTGGCGGC

EE2: AGTCACTGACCCAACCTTAAATGGCTG

55

35

1400

[37]

A. bovis

16S rRNA

AB1f: CTCGTAGCTTGCTATGAGAAC

AB1r: TCTCCCGGACTCCAGTCTG

55

35

551

[26]

A. phagocytophilum

16S rRNA

SSAP2f: GCTGAATGTGGGGATAATTTAT

SSAP2r: ATGGCTGCTTCCTTTCGGTTA

55

35

641

[26]

A. marginale

msp4

Amargmsp4F: CTGAAGGGGGAGTAATGGG

Amargmsp4R: GGTAATAGCTGCCAGAGATTC

60

30

344

[38]

A. ovis

msp4

MSP43: CCGGATCCTTAGCTGAACAGAATCTTGC

MSP45: GGGAGCTCCTATGAATTACAGAGAATTGTTTAC

60

35

869

[39]

A. capra

gltA

gltAouterF: GCGATTTTAGAGTGYGGAGATTG

gltAouterR: TACAATACCGGAGTAAAAGTCA

55

35

1031

[1]

 

gltAinnerF: GCGATTTTAGAGTGYGGAGATTG

gltAinnerR: GCGATTTTAGAGTGYGGAGATTG

60

35

594

 

16S rRNA

Forward: GCAAGTCGAACGGACCAAATCTGT

Reverse: CCACGATTACTAGCGATTCCGACTTC

58

35

1261

[35]

groEL

Forward: TGAAGAGCATCAAACCCGAAG

Reverse: CTGCTCGTGATGCTATCGG

55

35

874

[35]

Tick

16S rRNA

16SrRNA-F: CTGCTCAATGATTTTTTAAATTGCTGTGG

16SrRNA-R: CCGGTCTGAACTCAGATCAAGT

55

35

450

Designed for this study

The PCR products were purified with the TaKaRa Agarose Gel DNA Purification Kit Ver.2.0 (TaKaRa, Dalian, China). Purified PCR products were cloned into a pGEM-T Easy vector (Promega, Madison, WI, USA), and then transformed into Escherichia coli JM109 competent cells (TaKaRa, Dalian, China). Three positive colonies from each sample were subjected to sequencing. The obtained sequences were used to conduct BLAST search in GenBank® of the National Center for Biotechnology Information (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Data analysis

The data were grouped into three variables in terms of tick species, tick gender and the altitude of the sampling sites, respectively. Differences in each group were statistically calculated using a Chi-square test in Predictive for Analytics Software Statistics 18 (PASW, SPSS Inc.,Chicago, IL, USA). A P-value of < 0.05 was considered significant.

Results

Identification of the tick species

A total of 1104 questing adult ticks (512 female, 592 male) were collected from vegetation in 22 counties of Qinghai Province. The ticks included seven species in three genera. There were 454 Haemaphysalis qinghaiensis, 263 D. abaensis, 246 D. nuttalli, 94 D. silvarum, 42 H. danieli, 3 Ixode crenulatus and two H. tibetensis respectively (Fig. 1). The species of ticks identified by morphology and supported by sequence analysis. The 16S rRNA sequence of H. qinghaiensis showed 100% identity to H. qinghaiensis isolate HY21 (GenBank accession number: MF629877) from Huangyuan in Qinghai; D. nuttalli and D. silvarum showed 99% similarity to D. nuttalli isolate HBS5(GenBank accession number: KU558731) and D. silvarum isolate Hebei (GenBank accession number: JF979379) from Hebei Province in China. The 16S rRNA sequences of H. danieli, H. tibetensis, D. abaensis and I. crenulatus were obtained for the first time.
Fig. 1
Fig. 1

Map of the Sampling sites and the distribution of the collected tick species in Qinghai Province

Detection of the Anaplasma spp. in ticks

Five Anaplasma species were investigated in the ticks. Of the 1104 samples tested, the average infection rates were 3.1, 11.1, 5.6, and 4.5% for A. phagocytophilum, A. bovis, A. ovis, and A. capra, respectively. All of the samples were negative for A. marginale. A. phagocytophilum was detected in four tick species from ten sampling sites, and it was detected for the first time in D. abaensis, D. nuttalli, and H. danieli. A. bovis was detected in five tick species from 14 sampling sites, whereas A. ovis was detected in three tick species from nine sampling sites. Three tick species including H. qinghaiensis, D. abaensis and D. nuttalli were infected by A. capra. The prevalence of Anaplasma spp. in each sampling site is shown in Table 2.
Table 2

Detection of Anaplasma spp. in the ticks collected from 22 counties in Qinghai Province

County/Average altitude

Tick species

Number of tested

Number of infected (n)/Infection rate (%)

A. phagocytophilum

A. bovis

A. ovis

A. capra

Ledu/2000 m

H. qinghaiensis

57

0

0

10/17.5

17/29.8

Huangzhong/2645 m

H. qinghaiensis

57

7/12.3

14/24.6

5/8.8

14/24.6

Qumalai/4223 m

D. abaensis

51

0

2/3.9

0

5/9.8

Yushu/4493 m

D. abaensis

55

0

16/29.1

0

7/12.7

Maduo/4300 m

H. qinghaiensis

48

1/2.1

9/18.8

0

1/2.1

 

D. abaensis

3

0

0

0

0

Maqin/3730 m

D. abaensis

38

2/5.3

7/18.6

3/7.9

1/2.6

 

H. qinghaiensis

5

0

1/33.3

0

0

Mengyuan/2880 m

H. qinghaiensis

58

1/1.7

19/32.8

0

0

 

D. silvarum

1

0

0

0

0

Tianjun/3180 m

D. silvarum

54

0

0

0

0

Delingha/2980 m

D. silvarum

39

0

0

0

0

Chengduo/4500 m

D. nuttalli

16

0

0

0

2/12.5

 

H. qinghaiensis

30

5/16.7

4/15.2

0

0

 

H. tibetensis

2

0

0

0

0

 

I. crenulatus

3

0

1/33.3

0

0

Banma/3560 m

H. qinghaiensis

43

0

0

0

0

Gangcha/3300 m

D. nuttalli

29

0

0

0

0

Huangyuan/2666 m

H. qinghaiensis

56

8/14.3

11/19.6

0

1/1.8

Qilian/2810 m

D. abaensis

66

0

2/3.0

6/9.1

0

 

D. nuttalli

17

0

0

0

0

Dulan/3180 m

D. nuttalli

31

1/3.2

0

4/12.9

0

Guinan/3100 m

D. nuttalli

51

0

1/2.0

14/27.5

0

Huzhu/2520 m

H. qinghaiensis

50

0

5/10.0

0

0

Zaduo/4200 m

D. abaensis

50

4/8.0

5/10.0

0

0

Guide/2200 m

H. danieli

42

4/8.5

5/100

0

0

Henanxian/3600 m

D. nuttalli

51

1/2.0

20/39.2

11/21.6

2/3.9

Minhe/1650 m

H. qinghaiensis

50

0

0

3/6.0

0

Geermu/2800 m

D. nuttalli

51

0

0

6/11.8

0

Total

 

1104

34/3.1

122/11.1

62/5.6

50/4.5

Molecular characterization was based on the partial sequences of 16S rRNA gene (642 and 551 bp) for A. phagocytophilum and A. bovis, msp4 gene (869 bp) for A. ovis, 16S rRNA, gltA and groEL genes (1261 bp, 594 bp and 874 bp) for A. capra. These sequences were generated from positive samples representing the different sampling sites. As listed in Table 3, A. ovis were grouped into four genotypes. A. phagocytophilum were classified into three genotypes, and they were 100% identical to sequences of strains Ap-SHX21, JC3–3, and ZAM dog-181 from sheep, Mongolian gazelles, and dogs, respectively. A. bovis were classified into five genotypes. The 16S rRNA gene sequences of A. capra showed 99.8–100% similarity to strain S62b from sheep and strain 9-13a from goat, and the groEL gene sequences were identical with strain tick102/China/2013 and M141a, respectively. These sequences showed a close relation to the sequences of strain HLJ-14 from a patient. In addition, two genotypes of gltA gene sequences of A. capra were obtained in this study.
Table 3

Genotyping of Anaplasma spp. in the ticks in Qinghai Province

Anaplasma spp.

Gene marker

Number of obtained sequences

Number of genotypes

GenBank accession numbers of obtained sequences

Reference sequences from GenBank

A. ovis

16S rRNA

47

4

MG940865, MG940866, MG940868, MG940867

MF071305, HQ456347, EF067341, HQ456350

A. phagocytophilum

16S rRNA

56

3

MG940877, MG940878, MG940879

KU321304, KM186948, LC269823

A. bovis

16S rRNA

40

5

MG940884, MG940881, MG940880, MG940882, MG940883

KU509990, HQ913645, EU682764, KJ639885, KF465981

A. capra

16S rRNA

28

2

MG940874, MG940873

MF066917 KX417196

 

groEL

20

2

MG940875, MG940876

KR261634, KX685888

 

gltA

18

2

MG940871 MG940872

KX417308, KX685885

Risk factors for Anaplasma infection to in the tick species

Risk factors, including tick species, gender, and altitude of sampling sites, were used as variables for statistical analysis of the infection patterns of Anaplasma spp. (Table 4). As a result, tick species was positively associated with the presence of A. phagocytophilum, A. capra, and A. ovis. H. danieli had a higher risk than other tick species to be infected with A. phagocytophilum. D. nuttalli had a higher risk to be infected with A. ovis. H. qinghaiensis was most likely to be infected by A. capra. Male ticks were more likely to be infected by A. bovis or A. capra than female ticks. Altitude was a risk factor to A. phagocytophilum, A. bovis and A. capra infections. Ticks collected below 3000 m areas had a higher risk for being infected by A. phagocytophilum and A. capra than in the ticks collected at elevations greater than 3000 m. A. bovis infection rates in ticks collected above 4000 m were higher than in the ticks collected below 4000 m.
Table 4

Patterns of Anaplasma spp. prevalence in the ticks, grouped by tick species, tick gender and the altitude of the sampling sites

Group

Number of tested

Number of infected (n)/Infection rate (%)

A. phagocytophilum

P-value

A. bovis

P-value

A. ovis

P-value

A. capra

P-value

Tick

H. qinghaiensis

454

22/4.8

0.0032

63/13.9

0.230

18/4.0

0.000057

33/7.3

0.0056

H. tibetensis

2

0

0

 

0

 

0

H. danieli

42

4/9.5

5/11.9

 

0

 

0

D. abaensis

263

6/2.3

32/12.2

 

9/3.4

 

13/4.9

D. silvarum

94

0

0

 

0

 

0

D. nuttalli

246

2/0.8

21/8.5

 

35/14.2

 

4/1.6

I. crenulatus

3

0

1/33.3

 

0

 

0

Gender

Female

512

16/3.1

0.935

47/9.2

0.045

23/4.5

0.312

14/2.7

0.0077

Male

592

18/3.0

75/12.7

39/6.6

36/6.1

Altitude

≤ 3000 m

461

20/4.3

0.015

54/11.7

0.037

30/6.5

0.316

32/6.9

0.000066

 

3000–3900 m

385

4/1.0

31/8.1

32/8.3

3/0.8

 

≥ 4000 m

258

10/3.9

37/14.3

0

15/5.8

Discussion

Qinghai is one of the five largest animal grazing regions in China. Grazing animal production is a supporting industry in this region. The Qinghai ecosystem is very suitable for ixodid tick infestation and 25 tick species in six genera has been reported [15]. In this study we collected seven tick species from three genera. These were H. qinghaiensis, H. tibetensis, H. danieli, D. abaensis, D. nuttalli, D. silvarum, and I. crenulatus. H. qinghaiensis is common in northwestern China, and it has been the dominant tick species in Qinghai since it was initially discovered in Huangyuan County [13]. In the present study, 41.1% of the collected ticks were H. qinghaiensis. Three Dermacentor spp. ticks (D. abaensis, D. nuttalli and D. silvarum) were frequently encountered on grazing livestock in high altitude areas (2800 to 4300 m), whereas I. crenulatus and H. tibetensis were rare. To verify the morphological identification of the tick species, the 16S rRNA gene sequences were analyzed. The sequences from H. qinghaiensis, D. nuttalli, and D. silvarum ticks were identical to their corresponding reference sequences in Genbank. The sequences of H. danieli, H. tibetensis, D. abaensis and I. crenulatus were compared with our reference sequences (data unpublished) because of the lack of the reference sequences in GenBank.

Aanaplasma prevalence in ticks demonstrated a wide distribution of A. phagocytophilum, A. bovis, A. ovis and A. capra. Among the Anaplasma species, A. phagocytophilum is an emerging tick-borne zoonotic pathogen of public health significance [16], and it has been detected in many tick species, including H. qinghaiensis, H. concinna, H. longicornis, I. persulcatus, and D. silvarum in China [1720]. We detected A. phagocytophilum in H. qinghaiensis, and, for the first time, found it in D. abaensis, D. nuttalli, and H. danieli. The 16S rRNA gene sequences represented three genotypes, which showed high identities to the sequences found in goats from Central and Southern China [21], these genotypes were different from the genotype identified from human samples. Therefore, the significance of these genotypes to public health needs further investigation. A. bovis was initially found as a pathogen of cattle but has also been reported in sheep, goats, wild deer, and dogs [5, 22, 23], indicating this agent has a broad host range. We detected A. bovis in five tick species (H. qinghaiensis, D. abaensis, D. nuttalli, I. crenulatus, and H. danieli) from 14 sampling sites and it has the highest infection rate when compared with A. phagocytophilum, A. ovis and A. capra. Five genotypes of A. bovis were found, demonstrating its diversity in the ticks of Qinghai. A. bovis can be found in many tick species, such as H. longicornis in China [24], Korea [25] and Japan [26]. A. bovis was also found in H. lagrangei in Thailand [27], H.concinna in Russia [28], H. megaspinosa in Japan [29]; Amblyomma variegatum and R. appendiculatus in Africa [30], Rhipicephalus evertsi in South Africa [31], and R. turanicus in Israel [32]. We found A. bovis in H. qinghaiensis, D. abaensis, D. nuttalli, I. crenulatus, and H. danieli ticks. Statistics analysis indicated that A. bovis was more likely to infect male ticks and ticks at altitude above 4000 m. This result may be related to the distribution of its mammal hosts, since the majority of the yak population lives at altitudes more than 4000 m.

A. ovis is widely distributed in Asia, Europe, Africa and North American. Several msp4 gene variants of A. ovis have been identified in sheep and goats in northwest regions of China [14, 33, 34]. D. nuttalli, Hyalomma asiaticum and Rhipicephalus pumilio are vectors of A. ovis in China [9]. We detected A. ovis in D. abaensis, D. nuttalli, H. tibetensis, and four msp4 gene variants were identified in ticks. These variants showed high similarities to those from Chinese and Spanish strains, indicating diversity of A. ovis in the study ticks.

A. capra was initially identified in goats, and was subsequently considered to be an emerging human pathogen [1]. A. capra was previously identified in H. qinghaiensis in Gansu Province, in H. longicornis in Shandong Province, and in I. persulcatus in Heilongjiang Province [35, 36]. We detected A. capra in H. qinghaiensis, D. abaensis, and D. nuttalli, and two genotypes were identified on the basis of gltA, 16S rRNA, groEL gene analysis. One genotype showed high sequence identity to the A. capra HLJ-14 strain, which had been reported in both goats and humans in China [1]. Another genotype showed low sequence identity to the strain HLJ-14 of A. capra, but high identity to an A. capra-like bacteria from H. qinghaiensis ticks [35]. Additionally, H. qinghaiensis is the dominant tick species for the infection of A. capra, and high prevalence occurs in the ticks found at altitudes less than 3000 m.

Although the present study has revealed the current status of ixodid tick infestation with Anaplasma spp. in the investigated areas, the specific biological vector for the individual Anaplasma species need to be further studied by transmission experiments. In addition, the infections of Anaplasma species in animals or humans should be investigated to understand the true impact of anaplasmosis in Qinghai Province.

Conclusions

We demonstrated the prevalence of A. bovis, A. ovis, A. phagocytophilum, and A. capra in ticks from 22 counties of Qinghai Province. Anaplasma infection in ticks is associated with the species, gender and distribution of the ticks. The prevalence of A. capra in ticks may be a threat to public health in Qinghai Province.

Abbreviations

gltA

Citrate synthase

groEL

Heat shock protein

Declarations

Acknowledgements

Qinghai Provincial Center for Animal Disease Control and Prevention assisted with tick collection in Qinghai province. We thank them for their help and constructive comments.

Funding

This study was financially supported by the National Key Research and Development Program of China (2016YFC1202000,2017YFD0501200);and the Jiangsu Co-Innovation Center Program for the Prevention and Control of Important Animal Infectious Diseases and Zoonoses, State Key Laboratory of Veterinary Etiological Biology Project.

Availability of data and materials

The datasets used or analyzed for this study are available from the corresponding author.

Authors’ contributions

HY and Z-JL designed this study and critically revised the manuscript. RH participated in study design, coordination, and manuscript revision. RH, Q-LN, and YQ-L participated in sample collection. RH, YJ, M-UM, ZC,Q-LN, and G-YL performed the experiments, data analysis, and drafted the manuscript. All of the authors read and approved the final manuscript.

Ethics approval and consent to participate

This study was approved by the Animal Ethics Committee of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

Consent for publication

All of the authors of this manuscript declare that we have seen and approved the submitted version of this manuscript. Not applicable any individual persons data.

Competing interests

The authors declare that they have no competing interests.

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Xujiaping 1, Lanzhou, 730046, China
(2)
Qinghai Provincial Center for Animal Disease Control and Prevention, Xining, 810003, China
(3)
Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou, 225009, China

References

  1. Li H, Zheng YC, Ma L, Jia N, Jiang BG, Jiang RR, et al. Human infection with a novel tick-borne Anaplasma species in China: a surveillance study. Lancet Infect Dis. 2015;15:663–70.View ArticleGoogle Scholar
  2. Dumler JS, Barbet AF, Bekker CPJ, Dasch GA, Palmer GH, Ray SC, et al. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and 'HGE agent' as subjective synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol. 2001;51:2145–65.View ArticleGoogle Scholar
  3. Battilani M, Arcangeli SD, Balboni A, Dondi F. Genetic diversity and molecular epidemiology of Anaplasma. Infect Genet Evol. 2017;49:195–211.View ArticleGoogle Scholar
  4. Ben SM, Belkahia H, Messadi L. Anaplasma spp. in North Africa: a review on molecular epidemiology, associated risk factors and genetic characteristics. Ticks Tick Borne Dis. 2018;9:543-55.Google Scholar
  5. Liu Z, Ma M, Wang Z, Wang J, Peng Y, Li Y, et al. Molecular survey and genetic identification of Anaplasma species in goats from central and southern China. Appl Environ Microbiol. 2012;78:464–70.View ArticleGoogle Scholar
  6. de la Fuente J, Massung RF, Wong SJ, Chu FK, Lutz H, Meli M, et al. Sequence analysis of the msp4 gene of Anaplasma phagocytophilum strains. J Clin Microbiol. 2005;43:1309–17.View ArticleGoogle Scholar
  7. Harvey JW, Simpson CF, Gaskin JM. Cyclic thrombocytopenia induced by a Rickettsia-like agent in dogs. J Infect Dis. 1978;137:182–8.View ArticleGoogle Scholar
  8. Rar V, Golovljova I. Anaplasma, Ehrlichia, and "Candidatus Neoehrlichia" bacteria: pathogenicity, biodiversity, and molecular genetic characteristics, a review. Infect Genet Evol. 2011;11:1842–61.View ArticleGoogle Scholar
  9. Yin H, Luo J. Ticks of small ruminants in China. Parasitol Res. 2007;101(Suppl2):S187–9.View ArticleGoogle Scholar
  10. Zhang Y, Lv Y, Zhang F, Zhang W, Wang J, Cui Y, et al. Molecular and phylogenetic analysis of Anaplasma spp. in sheep and goats from six provinces of China. J Vet Sci. 2016;17:523–9.View ArticleGoogle Scholar
  11. Li Y, Liu P, Wang C, Chen G, Kang M, Liu D, et al. Serologic evidence for Babesia bigemina infection in wild yak (Bosmutus) in Qinghai Province, China. J Wildl Dis. 2015;51:872–5.View ArticleGoogle Scholar
  12. Li K, Shahzad M, Zhang H, Jiang X, Mehmood K, Zhao X, et al. Socio-economic burden of parasitic infections in yaks from 1984-2017 on Qinghai Tibetan plateau of China-a review. Acta Trop. 2018;183:103–9.View ArticleGoogle Scholar
  13. Chen Z, Li Y, Liu Z, Ren Q, Ma M, Luo J, et al. Scanning electron microscopy of all parasitic stages of Haemaphysalis qinghaiensis Teng, 1980 (Acari: Ixodidae). Parasitol Res. 2014;113:2095–102.View ArticleGoogle Scholar
  14. Yang J, Han R, Niu Q, Liu Z, Guan G, Liu G, et al. Occurrence of four Anaplasma species with veterinary and public health significance in sheep, northwestern China. Ticks Tick Borne Dis. 2018;9:82–5.View ArticleGoogle Scholar
  15. Chen Z, Yang X, Bu F, Yang X, Yang X, Liu J. Ticks (Acari: ixodoidea: argasidae, ixodidae) of China. Exp Appl Acarol. 2010;51:393–404.View ArticleGoogle Scholar
  16. Chen SM, Dumler JS, Bakken JS, Walker DH. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J Clin Microbiol. 1994;32:589–95.PubMedPubMed CentralGoogle Scholar
  17. Yang J, Liu Z, Guan G, Liu Q, Li Y, Chen Z, et al. Prevalence of Anaplasma phagocytophilum in ruminants, rodents and ticks in Gansu, North-Western China. J Med Microbiol. 2013;62:254–8.View ArticleGoogle Scholar
  18. Chen Z, Liu Q, Liu JQ, Xu BL, Lv S, Xia S, et al. Tick-borne pathogens and associated co-infections in ticks collected from domestic animals in central China. Parasit Vectors. 2014;22(7):237.View ArticleGoogle Scholar
  19. Jiang JF, Jiang BG, Yu JH, Zhang WY, Gao HW, Zhan L, et al. Anaplasma phagocytophilum infection in ticks, China-Russia border. Emerg Infect Dis. 2011;17:932–4.View ArticleGoogle Scholar
  20. Cao WC, Zhao QM, Zhang PH, Yang H, Wu XM, Wen BH, et al. Prevalence of Anaplasma phagocytophila and Borrelia burgdorferi in Ixodes persulcatus ticks from northeastern China. Am J Trop Med Hyg. 2003;68:547–50.View ArticleGoogle Scholar
  21. Yang J, Liu Z, Niu Q, Liu J, Guan G, Xie J, et al. First molecular survey and identification of Anaplasma spp. in white yaks (Bosgrunniens) in China. Parasitology. 2016;143:686–91.View ArticleGoogle Scholar
  22. Ben Said M, Belkahia H, Karaoud M, Bousrih M, Yahiaoui M, Daaloul-Jedidi M, et al. First molecular survey of Anaplasma bovis in small ruminants from Tunisia. Vet Microbiol. 2015;179:322–6.View ArticleGoogle Scholar
  23. Atif FA. Alpha proteobacteria of genus Anaplasma (Rickettsiales: Anaplasmataceae): epidemiology and characteristics of Anaplasma species related to veterinary and public health importance. Parasitology. 2016;143:659–85.View ArticleGoogle Scholar
  24. Qin XR, Han FJ, Luo LM, Zhao FM, Han HJ, Zhang ZT, et al. Anaplasma species detected in Haemaphysalis longicornis tick from China. Ticks Tick Borne Dis. 2018;9:840–3.View ArticleGoogle Scholar
  25. Lee MJ, Chae JS. Molecular detection of Ehrlichia chaffeensis and Anaplasma bovis in the salivary glands from Haemaphysalis longicornis ticks. Vector Borne Zoonotic Dis. 2010;10:411–3.View ArticleGoogle Scholar
  26. Kawahara M, Rikihisa Y, Lin Q, Isogai E, Tahara K, Itagaki A, et al. Novel genetic variants of Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma centrale, and a novel Ehrlichia sp. in wild deer and ticks on two major islands in Japan. Appl Environ Microbiol. 2006;72:1102–9.View ArticleGoogle Scholar
  27. Parola P, Cornet JP, Sanogo YO, Miller RS, Thien HV, Gonzalez JP, et al. Detection of Ehrlichia spp., Anaplasma spp., Rickettsia spp., and other Eubacteria in ticks from the Thai-Myanmar border and Vietnam. J Clin Microbiol. 2003;41:1600–8.View ArticleGoogle Scholar
  28. Shpynov S, Fournier PE, Rudakov N, Tarasevich I, Raoult D. Detection of members of the genera Rickettsia, Anaplasma, and Ehrlichiain ticks collected in the Asiatic part of Russia. Ann N Y Acad Sci. 2006;1078:378–83.View ArticleGoogle Scholar
  29. Yoshimoto K, Matsuyama Y, Matsuda H, Sakamoto L, Matsumoto K, Yokoyama N, et al. Detection of Anaplasma bovis and Anaplasma phagocytophilum DNA from Haemaphysalis megaspinosa in Hokkaido, Japan. Vet Parasitol. 2010;168:170–2.View ArticleGoogle Scholar
  30. Sumption KJ, Scott GR, Coetzer JAW, Tustin RC. Lesser-known rickettsias infecting livestock. ABC Press. 2004;2:536–49.Google Scholar
  31. Tonetti N, Berggoetz M, Ruhle C, Pretorius AM, Gern L. Ticks and tick-borne pathogens from wildlife in the free state province, South Africa. J Wildl Dis. 2009;45:437–46.View ArticleGoogle Scholar
  32. Harrus S, Perlman-Avrahami A, Mumcuoglu KY, Morick D, Eyal O, Baneth G. Molecular detection of Ehrlichia canis, Anaplasma bovis,Anaplasma platys,Candidatus Midichloria mitochondrii and Babesia canis vogeli in ticks from Israel. Clin Microbiol Infect. 2011;17:459–63.View ArticleGoogle Scholar
  33. Han R, Yang J, Liu Z, Gao S, Niu Q, Hassan MA, et al. Characterization of Anaplasma ovis strains using the major surface protein 1a repeat sequences. Parasit Vectors. 2017;10:447.View ArticleGoogle Scholar
  34. Renneker S, Abdo J, Salih DE, Karagenc T, Bilgic H, Torina A, et al. Can Anaplasma ovis in small ruminants be neglected any longer? Transbound Emerg Dis. 2013;60(Suppl 2):105–12.View ArticleGoogle Scholar
  35. Yang J, Liu Z, Niu Q, Liu J, Han R, Liu G, et al. Molecular survey and characterization of a novel Anaplasma species closely related to Anaplasma capra in ticks, northwestern China. Parasit Vectors. 2016;9:603.View ArticleGoogle Scholar
  36. Sun XF, Zhao L, Wen HL, Luo LM, Yu XJ. Anaplasma species in China. Lancet Infect Dis. 2015;15:1263–4.View ArticleGoogle Scholar
  37. Barlough JE, Madigan JE, Derock E, Bigornia L. Nested polymerase chain reaction for detection of Ehrlichia equi genomic DNA in horses and ticks (Ixodes pacificus). Vet Parasitol. 1996;63:319–29.View ArticleGoogle Scholar
  38. Torina A, Agnone A, Blanda V, Alongi A, D'Agostino R, Caracappa S, et al. Development and validation of two PCR tests for the detection of and differentiation between Anaplasma ovis and Anaplasma marginale. Ticks Tick Borne Dis. 2012;3:283–7.View ArticleGoogle Scholar
  39. de la Fuente J, Atkinson MW, Naranjo V, Fernández de Mera IG, Mangold AJ, Keating KA, et al. Sequence analysis of the msp4 gene of Anaplasma ovis strains. Vet Microbiol. 2007;119:375–81.View ArticleGoogle Scholar

Copyright

© The Author(s). 2019

Advertisement